hepad38  (ATCC)

Journal: Journal of Clinical and Translational Hepatology

Article Title: Paclitaxel-induced Immune Dysfunction and Activation of Transcription Factor AP-1 Facilitate Hepatitis B Virus Replication

doi: 10.14218/JCTH.2023.00537

Figure Lengend Snippet: (A–C) qPCR assay was employed to quantify the levels of HBV 3.5-Kb mRNA, HBV DNA, and HBV cccDNA in both HepAD38 cells and HepG2-NTCP cells following PTX treatment. (D–E) Immunoblot analysis of HBcAg expression levels in HepAD38 cells and HepG2-NTCP cells. Densitometry analysis was used to measure the relative levels of HBcAg. (F) Results of ELISA showing HBeAg levels in the culture medium supernatants of HepAD38 cells and HepG2-NTCP cells. Mean±SD values from three independent experiments are presented. Statistical significance was assessed using the t -test. * p <0.05, ** p <0.01, *** p <0.001. HBV, hepatitis B virus; PTX, paclitaxel; HBV cccDNA, HBV covalently closed circular DNA; HBcAg, hepatitis B core antigen; HBeAg, hepatitis B e-antigen; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Article Snippet: HepAD38 (HB-8065, ATCC, Manassas, VA, USA) cells were obtained from the American Type Culture Collection, while HepG2-NTCP cells were generously provided by Prof. Ningshao Xia (Xiamen University, Fujian, China).

Techniques: Western Blot, Expressing, Enzyme-linked Immunosorbent Assay, Virus

Journal: Journal of Clinical and Translational Hepatology

Article Title: Paclitaxel-induced Immune Dysfunction and Activation of Transcription Factor AP-1 Facilitate Hepatitis B Virus Replication

doi: 10.14218/JCTH.2023.00537

Figure Lengend Snippet: (A) Gene expression of HBV replication-associated transcription factors in HepAD38 cells analyzed by qPCR. (B) Immunoblot analysis of c-Jun expression levels in HepAD38 cells after PTX treatment. Relative levels of c-Jun were measured by densitometry. (C) Immunohistochemical staining of c-Jun in the liver tissue (scale bar: 60 µm). (D–E) Transcription and protein expression of AP-1 in HepAD38 cells following AP-1 silencing. (F–H) qPCR analysis of 3.5-kb mRNA, HBV DNA, and HBV cccDNA expression levels following AP-1 silencing. (I–J) Quantitative analysis of ELISA for HBeAg and HBsAg levels in HepAD38 cells following AP-1 silencing. (K) Immunoblot analysis of HBcAg expression levels in HepAD38 and HepG2-NTCP following AP-1 silencing. Mean ± SD values from 3 independent experiments are presented. * p <0.05, ** p <0.01, *** p <0.001. PTX, paclitaxel; AP-1, activator protein 1; HBV, hepatitis B virus; HBeAg, hepatitis B e-antigen; HBsAg, hepatitis B surface antigen; HBV cccDNA, HBV covalently closed circular DNA; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Article Snippet: HepAD38 (HB-8065, ATCC, Manassas, VA, USA) cells were obtained from the American Type Culture Collection, while HepG2-NTCP cells were generously provided by Prof. Ningshao Xia (Xiamen University, Fujian, China).

Techniques: Gene Expression, Western Blot, Expressing, Immunohistochemical staining, Staining, Enzyme-linked Immunosorbent Assay, Virus

Journal: Journal of Clinical and Translational Hepatology

Article Title: Paclitaxel-induced Immune Dysfunction and Activation of Transcription Factor AP-1 Facilitate Hepatitis B Virus Replication

doi: 10.14218/JCTH.2023.00537

Figure Lengend Snippet: (A) HepG2-NTCP cells treated with 4 µM PTX for 48 h after 12 h of transfection with HBV core, PreS1, PreS2, or X promoter luciferase reporter vectors. (B) Dual-luciferase reporter assays for detecting the effect of silencing AP-1 on HBV promoter activity. (C) CHIP-qPCR assay was used to detect the interaction between AP-1 and HBV core promoter. (D–F) Quantitative analysis of qPCR results showing the effect of silencing AP-1 on the PTX regulation of 3.5-kb mRNA, HBV DNA, and HBV cccDNA levels in HepAD38 cells. (G–H) ELISA analysis of the effect of silencing AP-1 in HepAD38 cells on PTX regulation of HBeAg and HBsAg levels. (I) Immunoblot analysis of HBcAg expression levels in AP-1 silenced HepAD38 cells. +, siAP-1 or PTX; – , siControl or DMSO. (J–L) HepG2 cells were transfected with pGEM-HBV1.3 or pGEM-HBV1.3MUT, and then treated with 4 µM PTX. qPCR assay was employed to quantify the levels of HBV 3.5-Kb mRNA, HBV DNA, and HBV cccDNA. (M–O) ELISA assays were used to detect HBeAg and HBsAg levels in the culture medium supernatant. (O) Immunoblot analysis of HBcAg expression levels in HepG2 cells. Mean±SD values from three independent experiments are presented. * p <0.05, ** p <0.01, *** p <0.001. PTX, paclitaxel; HBV Cp, HBV core promoter; HBV Xp, HBV X promoter; HBV Sp1, HBV pre S1 promoter; HBV Sp2, HBV pre S2 promoter; AP-1, activator protein 1; HBV, hepatitis B virus; WT, wild type; Mut, mutant; HBcAg, hepatitis B core antigen; HbeAg, hepatitis B e-antigen; HbsAg, hepatitis B surface antigen; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Article Snippet: HepAD38 (HB-8065, ATCC, Manassas, VA, USA) cells were obtained from the American Type Culture Collection, while HepG2-NTCP cells were generously provided by Prof. Ningshao Xia (Xiamen University, Fujian, China).

Techniques: Transfection, Luciferase, Activity Assay, ChIP-qPCR, Enzyme-linked Immunosorbent Assay, Western Blot, Expressing, Virus, Mutagenesis

Journal: Cell reports

Article Title: Macrophages activated by hepatitis B virus have distinct metabolic profiles and suppress the virus via IL-1β to downregulate PPARα and FOXO3.

doi: 10.1016/j.celrep.2021.110284

Figure Lengend Snippet: Figure 4. Suppression of HBV ENI and ENII enhancers by macrophages (A) HBV ENI or ENII enhancer reporter construct was co-transfected with pUC19 or pHBV1.3mer into Huh7 cells. The renilla luciferase reporter pRL-TK was also used in the co-transfection to monitor the transfection efficiency. Cells with (M4+) or without (M4–) co-culturing with THP-1 macrophages for 2 days were then lysed for the measurement of luciferase activities. (B) The ENI reporter constructs with different deletions are illustrated to the left. These reporter constructs were transfected into HepAD38 cells, and the relative luciferase activities of the reporter constructs in the absence () or presence (+) of macrophages are shown in the chart to the right. (C) The ENII reporter constructs with different deletions are illustrated to the left. The studies were conducted the same way as described in (B). (D) THP-1 macrophages reduced the activities of 1,136–1,168-luciferase (Luc) and 1,403–1,455-Luc reporter constructs in HepAD38 cells. (E) Hepatocytes isolated from control or TGD mice that had been injected with 20 mg pHBV1.3mer were transfected with the ENI reporter constructs ex vivo. These hepatocytes, with (+) or without () the subsequent co-culturing with their paired KCs isolated from the same mice, were then lysed for analysis of the reporter activities. (F) The study was conducted the same way as in (E), with the exception that ENII reporter constructs were analyzed. The results represent the mean ± SEM of three independent experiments. N.S., not significant; *p < 0.05; **p < 0.01; ***p < 0.001. See also Figure S4.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chromium Next GEM Single Cell 3’ Kit v3.1 (4 rxns) 10x genomics Cat# 1000269 Dual index kit TT set A (For Gene Expression Libraries) 10x genomics Cat# 1000215 Deposited data RNA-seq (Raw and analyzed data) This study GEO: GSE179618 Experimental models: Cell lines Huh7 This paper N/A HepG2 ATCC Cat# HB-8065 HepAD38 This paper N/A THP-1 ATCC Cat# TIB-202 Experimental models: Organisms/strains Mouse: C57BL/6J Jackson laboratory Stock No: 000664 TG05 HBV transgenic mice This paper N/A Oligonucleotides human GAPDH (Forward Primer) GATTCCACCCATGGCAAATTC This paper N/A human GAPDH (Reverse Primer) CTGGAAGATGGTGATGGGATT This paper N/A human IL-1b (Forward Primer) ATGACCTGAGCACCTTCTTTC This paper N/A human IL-1b (Reverse Primer) TGCACATAAGCCTCGTTATCC This paper N/A human TNF-a (Forward Primer) GCGTGGAGCTGAGAGATAAC This paper N/A human TNF-a (Reverse Primer) TGAAGAGGACCTGGGAGTAG This paper N/A human CD163 (Forward Primer) GGGATGTCCAACTGCTATCAA This paper N/A human CD163 (Reverse Primer) GACTCATTCCCACGACAAGAA This paper N/A human IL-10 (Forward Primer) GCTGGAGGACTTTAAGGGTTAC This paper N/A human IL-10 (Reverse Primer) GATGTCTGGGTCTTGGTTCTC This paper N/A mouse GAPDH (Forward Primer) AACAGCAACTCCCACTCTTC This paper N/A mouse GAPDH (Reverse Primer) CCTGTTGCTGTAGCCGTATT This paper N/A mouse IL-1b (Forward Primer) GAGGACATGAGCACCTTCTTT This paper N/A mouse IL-1b (Reverse Primer) GCCTGTAGTGCAGTTGTCTAA This paper N/A mouse TNF-a (Forward Primer) CCTCTTCTCATTCCTGCTTGT This paper N/A mouse TNF-a (Reverse Primer) TGGGAACTTCTCATCCCTTTG This paper N/A mouse CD163 (Forward Primer) CAGACTGGTTGGAGGAGAAATC This paper N/A mouse CD163 (Reverse Primer) CAGCTTCCAGAGACAAGTCAA This paper N/A (Continued on next page) e3 Cell Reports 38, 110284, January 25, 2022

Techniques: Construct, Transfection, Luciferase, Cotransfection, Isolation, Control, Injection, Ex Vivo

Journal: Cell reports

Article Title: Macrophages activated by hepatitis B virus have distinct metabolic profiles and suppress the virus via IL-1β to downregulate PPARα and FOXO3.

doi: 10.1016/j.celrep.2021.110284

Figure Lengend Snippet: Figure 5. Macrophages and IL-1b suppress the binding of PPARa to ENI and FOXO3 to ENII (A) The binding of HNF4a, RXRa, PPARa, and COUP-TF1 to the ENI enhancer (top panel) or FOXO3 to the ENII enhancer (bottom panel) was analyzed by the ChIP assay using HepAD38 cells with (M4+) or without (M4-) co-culturing with THP-1 macrophages. The control IgG served as the negative control. ‘‘Input’’, total cell lysates without the step of immunoprecipitation to serve as the positive control. (B) The same ChIP assay as shown in (A) was conducted using HCs isolated from HBV transgenic mice with (IL-1b+) or without (IL-1b–) the injection of IL-1b. (C) The binding of PPARa to nt 1,136–1168 of ENI1 was analyzed by the EMSA. The double-stranded oligonucleotide containing the sequence of nt 1,136–1,168 was used as the probe for incubation with the HepG2 nuclear extracts. The nucleotide mutations of the mutant probe are shown in (E).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chromium Next GEM Single Cell 3’ Kit v3.1 (4 rxns) 10x genomics Cat# 1000269 Dual index kit TT set A (For Gene Expression Libraries) 10x genomics Cat# 1000215 Deposited data RNA-seq (Raw and analyzed data) This study GEO: GSE179618 Experimental models: Cell lines Huh7 This paper N/A HepG2 ATCC Cat# HB-8065 HepAD38 This paper N/A THP-1 ATCC Cat# TIB-202 Experimental models: Organisms/strains Mouse: C57BL/6J Jackson laboratory Stock No: 000664 TG05 HBV transgenic mice This paper N/A Oligonucleotides human GAPDH (Forward Primer) GATTCCACCCATGGCAAATTC This paper N/A human GAPDH (Reverse Primer) CTGGAAGATGGTGATGGGATT This paper N/A human IL-1b (Forward Primer) ATGACCTGAGCACCTTCTTTC This paper N/A human IL-1b (Reverse Primer) TGCACATAAGCCTCGTTATCC This paper N/A human TNF-a (Forward Primer) GCGTGGAGCTGAGAGATAAC This paper N/A human TNF-a (Reverse Primer) TGAAGAGGACCTGGGAGTAG This paper N/A human CD163 (Forward Primer) GGGATGTCCAACTGCTATCAA This paper N/A human CD163 (Reverse Primer) GACTCATTCCCACGACAAGAA This paper N/A human IL-10 (Forward Primer) GCTGGAGGACTTTAAGGGTTAC This paper N/A human IL-10 (Reverse Primer) GATGTCTGGGTCTTGGTTCTC This paper N/A mouse GAPDH (Forward Primer) AACAGCAACTCCCACTCTTC This paper N/A mouse GAPDH (Reverse Primer) CCTGTTGCTGTAGCCGTATT This paper N/A mouse IL-1b (Forward Primer) GAGGACATGAGCACCTTCTTT This paper N/A mouse IL-1b (Reverse Primer) GCCTGTAGTGCAGTTGTCTAA This paper N/A mouse TNF-a (Forward Primer) CCTCTTCTCATTCCTGCTTGT This paper N/A mouse TNF-a (Reverse Primer) TGGGAACTTCTCATCCCTTTG This paper N/A mouse CD163 (Forward Primer) CAGACTGGTTGGAGGAGAAATC This paper N/A mouse CD163 (Reverse Primer) CAGCTTCCAGAGACAAGTCAA This paper N/A (Continued on next page) e3 Cell Reports 38, 110284, January 25, 2022

Techniques: Binding Assay, Control, Negative Control, Immunoprecipitation, Positive Control, Isolation, Transgenic Assay, Injection, Sequencing, Incubation, Mutagenesis

Journal: Cell reports

Article Title: Macrophages activated by hepatitis B virus have distinct metabolic profiles and suppress the virus via IL-1β to downregulate PPARα and FOXO3.

doi: 10.1016/j.celrep.2021.110284

Figure Lengend Snippet: Figure 6. Analysis of the effects of PPARa and FOXO3 on HBV gene expression (A) HepAD38 cells with replicating HBV were co-cultured with THP-1 macrophages for 2 days and lysed for western blot analysis of FOXO3, PPARa, and HBV core protein. GAPDH was used as the loading control. (B) Huh7 cells transfected with the pHBV1.3mer with or without co-culturing with THP-1 macrophages were lysed for western blot analysis of FOXO3, PPARa, HBsAg, and the HBV core protein. Huh7 cells transfected with pUC19 was used as the control. (C) Tg05 HBV transgenic mice were peritoneally injected with IL-1b (200 ng/mouse) with or without the co-injection of control IgG, anti-IL-1b antibody, or anakinra. Hepatocytes were isolated from mice 24 h later and lysed for western blot analysis. (D) Huh7 cells transduced with the lentiviral vector that expressed a scrambled shRNA (shNS), PPARa shRNA (shPPARa), or FOXO3 shRNA (shFOXO3) were transfected with the pHBV1.3mer. Cells were lysed 48 h later for western blot analysis. (E) Experiments were conducted the same way as in (D), followed by northern blot analysis of HBV RNAs.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chromium Next GEM Single Cell 3’ Kit v3.1 (4 rxns) 10x genomics Cat# 1000269 Dual index kit TT set A (For Gene Expression Libraries) 10x genomics Cat# 1000215 Deposited data RNA-seq (Raw and analyzed data) This study GEO: GSE179618 Experimental models: Cell lines Huh7 This paper N/A HepG2 ATCC Cat# HB-8065 HepAD38 This paper N/A THP-1 ATCC Cat# TIB-202 Experimental models: Organisms/strains Mouse: C57BL/6J Jackson laboratory Stock No: 000664 TG05 HBV transgenic mice This paper N/A Oligonucleotides human GAPDH (Forward Primer) GATTCCACCCATGGCAAATTC This paper N/A human GAPDH (Reverse Primer) CTGGAAGATGGTGATGGGATT This paper N/A human IL-1b (Forward Primer) ATGACCTGAGCACCTTCTTTC This paper N/A human IL-1b (Reverse Primer) TGCACATAAGCCTCGTTATCC This paper N/A human TNF-a (Forward Primer) GCGTGGAGCTGAGAGATAAC This paper N/A human TNF-a (Reverse Primer) TGAAGAGGACCTGGGAGTAG This paper N/A human CD163 (Forward Primer) GGGATGTCCAACTGCTATCAA This paper N/A human CD163 (Reverse Primer) GACTCATTCCCACGACAAGAA This paper N/A human IL-10 (Forward Primer) GCTGGAGGACTTTAAGGGTTAC This paper N/A human IL-10 (Reverse Primer) GATGTCTGGGTCTTGGTTCTC This paper N/A mouse GAPDH (Forward Primer) AACAGCAACTCCCACTCTTC This paper N/A mouse GAPDH (Reverse Primer) CCTGTTGCTGTAGCCGTATT This paper N/A mouse IL-1b (Forward Primer) GAGGACATGAGCACCTTCTTT This paper N/A mouse IL-1b (Reverse Primer) GCCTGTAGTGCAGTTGTCTAA This paper N/A mouse TNF-a (Forward Primer) CCTCTTCTCATTCCTGCTTGT This paper N/A mouse TNF-a (Reverse Primer) TGGGAACTTCTCATCCCTTTG This paper N/A mouse CD163 (Forward Primer) CAGACTGGTTGGAGGAGAAATC This paper N/A mouse CD163 (Reverse Primer) CAGCTTCCAGAGACAAGTCAA This paper N/A (Continued on next page) e3 Cell Reports 38, 110284, January 25, 2022

Techniques: Gene Expression, Cell Culture, Western Blot, Control, Transfection, Transgenic Assay, Injection, Isolation, Transduction, Plasmid Preparation, shRNA, Northern Blot